miércoles, 16 de noviembre de 2016

advertencia

si me pongo frágil voy a quebrarme en pequeños pequeños pedacitos
y si algo desaprendí y estoy volviendo a aprender, lento y a porrazos, es a confiar en mi
en mis instintos, en la tripa y en la mente
(no vuelvo a ser juguete de nadie)
y al primer paso en falso, voy a correr
o peor
voy a comer
me
al mundo
y en eso, te tragaré a ti también!


martes, 15 de noviembre de 2016

dunas

y si llegaras corriendo a mi, a quererme como fue hace años, podría quedarme esta vez, siquiera?


le tengo miedo, caleta de miedo, a lo frágil que me vuelvo cerca tuyo
a veces creo que eso es más fuerte, y que no importa cuanto espere
al momento en que logres llegar, yo ya no voy a poder seguir ahí

ese es el perderte
es más real que mi enojo, que mi pena, que el posible desamor
darme cuenta que mientras más tiempo pasa, estás tú más lejos de todo lo que necesito para vivir.

viernes, 11 de noviembre de 2016

fundida

tacatacatacatacataca

las remuneraciones, dentro de eso se puede rendir

tacatacatatcatatcatatcatcat

mira, la forma que tiene de proceder junji, es de todo vencido, todo - vencido.

tacatcatctaactatcatcta

hay que invertir, ponerle plata a los jardines, y recuperarla después.

tacattacatata click catacatactat

pero él tampoco tiene la voluntad de entender este contexto tampoco po!

swish swish tacatcatacatac click [....] necesito.... [....] Mira, dime si está bien. se lo mando al Marcelo y a la Claudia, con copia al boris y al.... estimado:

tacatcatca click click.

a mi me mandó a ver la hueá del cierre perimetral, pero del cierre del colegio, no del jardín po

pero él me mandó a hacer los talleres en la tarde, y yo ya lo hice. Pero no, no le he dicho que ya hice la "tarea" [risas]

no es santa margarita sin número. esa es la dirección del goretti? santa margarita, sin numero? si se entra por ocho... así dan las direcciones acá en concón, si no hay ninguna puerta por ahí por santa margarita, qué quieren, que se salte uno la muralla? [risas]

mira esto, el festival de la semilla.
no te dije que va a hace una él solo? y no lo autoricé po! yo te dije... pero eso es usurpación de nombre [risas]

tacatacatctatcatatcatatacatacat

sesión número ocho del plan de intervención.

[risas] vi el puro signo de interrogación, pensé que te referías al de arriba.

ese no es colega, no? no, no es colega

y estay hablando con un cabro que no entiende ná, no entiende ná. Y yo te lo entiendo, y está claro, y está bien pero....

ay estay hablando del hueón como que fuera...

PIE!? [risas]

mensual, mensual, correspondiente a 5 meses de niveles de atención. Oye qué terrible, ya pero cómo tanto, me perturba que no entienda.

tacatacatacatacatcatca

buenos dias, podria hablar con ingrid?






Atrás suenan las máquinas de los maestros trabajando en el colegio al otro lado de la muralla. 
En la ventana, Concón se está nublando de nuevo, una vez más, en un día pronosticado con un clima de 20 grados. El limón del patio se empieza a mover con el viento. las sillitas giratorias crujen, crujen, y el aire está pesado por los gases del vecino de la oficina de al lado, me gustaría cerrar la puerta. 
Silvan los celulares, y las piernas se me marcan cuando me siento "a lo indio", se enrrojecen en el empeine. La puerta se abre y se cierra y la gente entra y sale y comenta y se ríe. Yo sólo tengo sueño.  



de cabildo, la ligua.
LA LIGUA? no, están cagaos esos conchesumares