martes, 27 de diciembre de 2016

sleepyhead

al final, ya no espero ninguna micro
me quedé sentada acá al borde del caminito viendo pasar a la gente
me encontré a más de una persona que quiere sentarse conmigo

domingo, 25 de diciembre de 2016

-

diría que esta es la última semana, la que lo define todo, pero no sería verdad. lo cierto que es que todo lo que me ha llevado hasta acá, decisión tras decisión, accidente tras accidente o circunstancia tras circunstancia, se han apilado hasta el día de hoy, pero no es una consecuencia: es sólo un reflejo.
todo ha sido un paso tras otro, nada es causa y nada es consecuencia. es sólo una larga, larga línea.

y he sentido que todo se acaba ahora, aunque no sea así. he sentido que acabo con un proceso largo, pero no quiero hablar de eso. he sentido que termino un amor muy grande, pero me cansa hablar de eso. he sentido que termino un tratamiento, y eso hace que mi cabeza zumbe, de nuevo. y es difícil pensar así. y te acuerdas de por qué querías terminar las cosas antes, lo antes posible. por qué ni siquiera me siento triste, sólo zumba, sin parar, sin parar, sin dejarme hablar, sin dejarme entenderme, hablando sin sentidos en mis oídos. no quiero decir nada, no quiero decir nada que sea un paso en falso. sólo terminar esto, y esto, y esto, y esto, y esto.

sábado, 24 de diciembre de 2016

'entre lo que nunca fue y nunca será'


pero tú siempre fuiste real
tan real
que es más fácil dudar del resto del mundo...
siempre fue más fácil dudar del resto del mundo



Meet in the night like this is wrong

Think of the life left once we're gone
i wont go back
i wont go back
i love this too much




si no hay como retroceder
si avanzo
significa que aún
si avanzo, significa que
aún



Met in the night like it was wrong

Laugh at the life now that we're gone
i wont go back
i wont go back




si avanzo
y no vuelvo

si doy un paso más allá









i love you too much


no quiero volver 
jamás
aquí 

sábado, 17 de diciembre de 2016

besitos de despedida

ensoñadorcito indie pop de fondo
con sabor a chiclets de menta


tengo esperanzas todavía
en vivir de una forma nueva?

viernes, 16 de diciembre de 2016

oblivion

tengo esa hueá incontrolable de escribir
pero es porque me da miedo decir algunas cosas

siempre he usado este lugar para eso creo
ahora quiero decirlo como si practicase
para no quedarme con esto ahora
(y nunca más)

empezar cosas nuevas es difícil
querer de nuevo es difícil
dejar entrar a alguien es más que difícil
y caleta de años de ires y venires me han vuelto una persona
muy muy temerosa

pero tengo cositas, y no sé qué hacer con ellas
tengo muchas cositas
que no son sólo cositas recién llegadas, hay cositas también
que son muy muy viejas, cositas que han mutado con el tiempo
si al final, después de evaporado tanto enojo
siempre queda lo mismo
ahí al fondo

ahí al fondo, ahí al fondo
te veo todavía



Since I was young, I knew I'd find you
But our love was a song sung by a dying swan
And in the night, you hear me calling
You hear me calling
And in your dreams you see me falling, falling

Breathe in the light
I'll stay here in the shadow
Waiting for a sign, as the tide grows
Higher, and higher, and higher

And when the nights are long
All those stars recall your goodbye, your goodbye

And in the night you'll hear me calling, you'll hear me calling
And in your dreams you'll see us falling, falling
And in the night you'll hear me calling, you'll hear me calling
And in your dreams you'll see us falling, falling

Breathe in the light and say goodbye



Breathe in the light and say goodbye.







martes, 13 de diciembre de 2016

Ramblings de curá

Please dont go
Please dont go
I love you so
I love you so
(Please break my heart)

Please dont go
I'll eat you whole
I love you so
I love you so

lunes, 12 de diciembre de 2016

flash

"carlamalva, qué se siente estar enamorada de un cobarde?"


y si pudiera perderle la pista para siempre


viernes, 9 de diciembre de 2016

reflujos

tengo caleta de entradas en el borrador, porque hay días que estoy feliz, feliz y borracha y volá y pienso cosas bonitas mientras camino zigzagueando por los nortes para llegar a mi casa, con manitos calidas entre las mías y rabeos y mañas cual música de fondo. y bastan instantes para que ataque la neurósis y los fantasmas, y el miedo que le tengo a mis manos y a mis muñecas, el miedo que me agarra por los brazos y por los dientes, y los mensajes en negro que solo dicen hueás pencas, de mi y de todos, pencas al infinito y son pura basura pura basura pura basura y hacen que los odie a todos, pura basura pura basura pura basura todos, los cobardes, los mentirosos, los desleales, los que fingen, los que no sienten, los que se cortan del resto, los que desaparecen, los que no viven, todos basura  son todos basura todos todos basura, lo que son es todo basura, lo que somos, lo que somos todos,  y me doy a s c o, si al final soy pura basura

-

necesito volver a tomar en mis manitos las riendas de mi vida
este último tiempo me he sentido como la peor de las estúpidas  

viernes, 2 de diciembre de 2016

que mañana más de perro

hoy día no sé qué pasó
que desperté y adormilada y adolorida
pensé que no quería quererte nada más
nunca más, ni un poquito poquito más
y yo sé que me se va a pasar en un rato
pero me gusta dejar constancia de que
aunque mi paciencia sea infinita
extrañar me hace mal pal corazón de repente

y igual ya no extraño, ya no extraño nada
ya espero no más, como si esperar fuera la orden que me dio la Carla del pasado, a repetir, a repetir, a repetir
porque se me olvida a veces a quién, por qué, para qué
se me olvida qué fue lo que vi que fue tan importante, pero en confiar más en mi
sea la del presente, del pasado y del futuro
sigo esperando esperando esperando
porque ya no importa ver lo que vi
lo que importa es que lo vi
como guardar una canción con un par de palabras garabateadas en mi agenda
en confiar en mi y decir
que cuando la escuche de nuevo
lo voy a saber, ya lo supe, aunque lo olvide
ya lo supe 
y tengo que aprender a recordar las cosas que ya sé, recordar confiar en mi
o en la Carla del pasado, que no siempre estuvo mal, como (sí) siempre pensé


miércoles, 16 de noviembre de 2016

advertencia

si me pongo frágil voy a quebrarme en pequeños pequeños pedacitos
y si algo desaprendí y estoy volviendo a aprender, lento y a porrazos, es a confiar en mi
en mis instintos, en la tripa y en la mente
(no vuelvo a ser juguete de nadie)
y al primer paso en falso, voy a correr
o peor
voy a comer
me
al mundo
y en eso, te tragaré a ti también!


martes, 15 de noviembre de 2016

dunas

y si llegaras corriendo a mi, a quererme como fue hace años, podría quedarme esta vez, siquiera?


le tengo miedo, caleta de miedo, a lo frágil que me vuelvo cerca tuyo
a veces creo que eso es más fuerte, y que no importa cuanto espere
al momento en que logres llegar, yo ya no voy a poder seguir ahí

ese es el perderte
es más real que mi enojo, que mi pena, que el posible desamor
darme cuenta que mientras más tiempo pasa, estás tú más lejos de todo lo que necesito para vivir.

viernes, 11 de noviembre de 2016

fundida

tacatacatacatacataca

las remuneraciones, dentro de eso se puede rendir

tacatacatatcatatcatatcatcat

mira, la forma que tiene de proceder junji, es de todo vencido, todo - vencido.

tacatcatctaactatcatcta

hay que invertir, ponerle plata a los jardines, y recuperarla después.

tacattacatata click catacatactat

pero él tampoco tiene la voluntad de entender este contexto tampoco po!

swish swish tacatcatacatac click [....] necesito.... [....] Mira, dime si está bien. se lo mando al Marcelo y a la Claudia, con copia al boris y al.... estimado:

tacatcatca click click.

a mi me mandó a ver la hueá del cierre perimetral, pero del cierre del colegio, no del jardín po

pero él me mandó a hacer los talleres en la tarde, y yo ya lo hice. Pero no, no le he dicho que ya hice la "tarea" [risas]

no es santa margarita sin número. esa es la dirección del goretti? santa margarita, sin numero? si se entra por ocho... así dan las direcciones acá en concón, si no hay ninguna puerta por ahí por santa margarita, qué quieren, que se salte uno la muralla? [risas]

mira esto, el festival de la semilla.
no te dije que va a hace una él solo? y no lo autoricé po! yo te dije... pero eso es usurpación de nombre [risas]

tacatacatctatcatatcatatacatacat

sesión número ocho del plan de intervención.

[risas] vi el puro signo de interrogación, pensé que te referías al de arriba.

ese no es colega, no? no, no es colega

y estay hablando con un cabro que no entiende ná, no entiende ná. Y yo te lo entiendo, y está claro, y está bien pero....

ay estay hablando del hueón como que fuera...

PIE!? [risas]

mensual, mensual, correspondiente a 5 meses de niveles de atención. Oye qué terrible, ya pero cómo tanto, me perturba que no entienda.

tacatacatacatacatcatca

buenos dias, podria hablar con ingrid?






Atrás suenan las máquinas de los maestros trabajando en el colegio al otro lado de la muralla. 
En la ventana, Concón se está nublando de nuevo, una vez más, en un día pronosticado con un clima de 20 grados. El limón del patio se empieza a mover con el viento. las sillitas giratorias crujen, crujen, y el aire está pesado por los gases del vecino de la oficina de al lado, me gustaría cerrar la puerta. 
Silvan los celulares, y las piernas se me marcan cuando me siento "a lo indio", se enrrojecen en el empeine. La puerta se abre y se cierra y la gente entra y sale y comenta y se ríe. Yo sólo tengo sueño.  



de cabildo, la ligua.
LA LIGUA? no, están cagaos esos conchesumares

lunes, 31 de octubre de 2016

de dopamina y otras bazofias

tengo el corazón "cerrado por derribo", como dice la canción, y cuando empiezo a sentir cositas en el estómago por alguien nuevo, lo único que me pasa es que me da es miedo de estar recayendo en la vieja adiccion a la dopamina y a dependencia disfrazada de amor romántico. creo que hasta ahora, he podido construirme de nuevo, de a poquito, lentamente, pero ahora que he logrado abrirme y me he  involucrado con otras personas, me doy cuenta, y recuerdo de alguna forma, que no tengo todo conocido, y que mi dominio es pequeñito como la palma de mi mano. 

igual quiero un besito y un abracito ahora... pero el tiempo dice no más y yo me aguanto. 

martes, 11 de octubre de 2016

meestoypudriendopordentrooo

basta de soñar


la raíz de mis angustias, todavía en el pasado.




Here comes a thought that might alarm me
What someone said and how it harmed me
Something I did that failed to be charming
Things that I said are suddenly swarming


And, oh, I'm losing sight, I'm losing touch
All these little things seem to matter so much
That they confuse me

That I might lose me

miércoles, 28 de septiembre de 2016

Hoy día, se me murió de nuevo la Deli

y soñé que guardaba velitas, un 5 y un 6 azules en mis bolsillos, sacados del paquete en el super. todos sabemos que son caras esas hueás, tenían la alarma puesta, no sé por qué, sin son figuritas de cera no más. soñé que le cantabamos cumpleaños, como sabiendo que eso era lo último, era como el rito, no podí morirte sin soplar la velas, Deli. no podí morirte así no más. no podí morirte cuando entrego mi proyecto, no podí morirte sin venir a la casa de nuevo, no podí morirte sin decirme que lo hice bien.

y cuando fue el funeral, el que no soñé, me sentía extraña, me sentía pasada a llevar. si sabíai cómo son la cosas Deli, si sabíai que no podíai seguir en esa. si sabí esas cosas, si las sabí, Deli, las sabí.

mi casa hace semanas que no huele a cloro, mi ropa no tiene manchas, ya no encuentro sorpresas en los cajones y no me llegan berlines que alguien no se quiso comer. pero extraño hablar, más que nada, extraño cocinar con consejos y extraño mucho la compañía. era muy pronto, era muy encima. nos dejaste solas a todas po Deli. y cuando lo digo, suena más egoísta de cómo lo siento en verdad. solo no quería que te fuerai tan rápido, solo no quería que te fuerai así, no quería que se te fuera la vida en esa. tengo pena Deli, y estoy cansá, y no quería que te fuerai cansá. eso es todo.

lunes, 26 de septiembre de 2016

ese ruido po

y en saberme, los sueños siempre son mi guión.

a quienes resiento, a quienes extraño, quienes son mi otredad y cuál es mi deseo.
ya la tengo clara, ahora sólo tengo que tener el ánimo para hacerme cargo.

domingo, 25 de septiembre de 2016

escuchas eso?

tengo muchas entradas a medio escribir, porque han pasado tantas cosas, he empezado a hablar tantas veces sin poder terminar. siento que mi vida ahora es ese punto, por donde pasan muchas líneas, ese punto que tiene un nombre en matemáticas y te lo dicen cuando estás en el colegio; es ruido y silencios y movimientos interrumpidos, calmas y fases, capas, muchas capas, como nubes que se mueven a alta velocidad por sobre nubes estáticas, que se generan a sí mismas, ciclos y apareceres y desapariciones y todo es un ajetreo, y no lo entiendo y solo pasa rápido, como el ruido eterno que conoce quien vive cerca de una carretera.


pero escribir es lograr detenerme, incluso en la calma aparente (que es falsa, que no es real, que finge no ser movimiento pero solo está haciendo que mis pies caminen sin que yo me de cuenta), y escribir es dejarme inundar en los sentimientos que paso a llevar todos los días. escribir es decir que llevo guardando rabia, llevo cargando secretos que no pienso seguir teniendo en mi espalda. escribir es poder decir que el corazón se me aprieta cuando veo a la enanita triste, y se me derrite cuando la veo suave. escribir es poder decir que me nacen mariposas con personas que nunca pensé que pasaría, y es ser feliz al darme cuenta que puedo generar vínculos y relacionarme de formas que no esperé, que no me sentía capaz. es darme cuenta de que he crecido tanto, tanto, que a veces siento que miro por encima de los árboles, y que el cielo es infinito y que puedo lograr más, aunque sea en mi espacio tan pequeño. escribir es saber que no soy quién pensé que era, definida por el resto, aplastada por sus miedos. escribir es saber que me escribo todos los días, y que por fin soy yo la que tiene el lápiz en la mano. escribir es saberme, con todo el amor que tengo dentro, con toda la rabia también, es hacer mi propia ruta, mi "camino del ninja" con música de fondo y todo. a veces, sólo necesito escribirme, y para eso, tengo que escribir también.

martes, 30 de agosto de 2016

bb

Me da nervio tomarle la mano así. Me da un poco de miedo, verla mirarme con los ojitos verdes brillantes, verla roja, verla emocionada, verla feliz... de verme a mí. No sé si me estoy poniendo vieja, o me gusta creerme más vieja de lo que soy. No puedo ser hogar de nadie. No voy a ser un puerto seguro, y es probable que lo que gane de mí sea más a porrazos que por que haya algo que podamos construir. Es muy cínico, sentir que ya sé todo lo que viene. Justo ayer le decía que no podía pretender conocer todo lo que los otros piensan y hacen, ni por qué hacen lo que hacen o piensan lo que piensan. No está en ella, ni en mí, ni en nadie. Pero no puedo evitar sentir que tengo esto entre las manos, que es como una pequeña oruguita que puedo destrozar con los dedos, y me da miedo moverme mucho por si llegara a hacerlo sin querer.

Cuando me dice que me quiere, una parte de mí se revuelve de emoción, y la otra... siente que se cae un poquito más cerca del suelo.

miércoles, 17 de agosto de 2016

Deli cia

Siempre pienso que de a un punto a este momento en la vida, la gente solo se empieza a morir. Ya son suficientes funerales, aunque sea por ahora... déjenme tranquilo un ratito por favor.

lunes, 15 de agosto de 2016

agujas

tenía agujas en la piel. agujas largas, plateadas y delgadas, atravesando mis piernas por toda la superficie de mi piel. las veía introducirse lentamente, como guiadas por una mano invisible, y tenía miedo de que a cada pestañeo tuviese más y más agujas sembradas en mí. sabía de quién era la culpa, sabía de quién tenía que huir, pero no podía, era más rápida, era más hábil, era distinta y podía atravesarme sin mayor esfuerzo. lo que viene a continuación, ocurre como en una veloz nebulosa: la ayuda, la huída, la caída.
y luego, la repetición.
y enfrentar nuevamente a la mujer invisible metiendo sus agujas en mis piernas, con el recuerdo de haber vencido una vez, pero sin entender por qué tengo que escapar de ella de nuevo. ¿puedo repetir esta victoria? ¿estará la ayuda esperándome al otro lado del infierno?
no quiero volver a despertar con el sudor helado corriendo por mi espalda
quiero saber si puedo contar en alguien más

jueves, 11 de agosto de 2016

rr

do you wanna
do you wanna
do you wanna make love to me?

i know you wanna
i know you wanna
i know you wanna make love

to 

me

domingo, 31 de julio de 2016

déjame mirar

You're the one that I wanted to find
And anyone who tried to deny you
Must be out of their mind

me estoy ahogando en una pena que no tiene lágrimas. no recuerdo haber sentido una pena así de solitaria, tan adentro adentro de mi cabeza.

viernes, 22 de julio de 2016

te dije alguna vez que te amaba?

tengo caleta de cositas en el pecho. gente que ha pasado, brevemente, recientemente, o por largo tiempo. tengo tantas cositas en el pecho, que no puedo ni llorar.
estoy completa
absoluta
y definitivamente
en la nada

jueves, 30 de junio de 2016

pausa

ya hay tan poco que sienta que valga la pena escribir, no como sucesos, sino como adentro de mi cabeza. pero escribo igual, escribo igual, porque siento que algo va a desaparecer ahí adentro si dejo de escribir.

lunes, 27 de junio de 2016

no subject

paso muchos días haciendo como que nada pasa, y en verdad nada lo hace, pero hoy día, perdón, ahora, no hay ruido de fondo ni ansiedad ni temblores ni crisis, sólo una pena grande en el fondo del corazón. cuando despierte, si todo está bien, se habrá ido y volverá el resto, pero hoy me voy a dormir con el pecho apretado, sin ninguna certeza, sin ninguna expectativa.

lunes, 20 de junio de 2016

otra

Una vez, hace ya un par de años, una psicóloga me dijo que no podía pedir más de quién no puede dar. Siempre esperé que mi mamá, en un arranque hollywoodense, entendiera de golpe, se sensibilizara como por arte de magia, y se conmoviera por la cantidad de dolor que traigo encima. Después de un tiempo, dejé de intentarlo, y dejé de esperar también. Empecé a fingir un poco más, empecé a manejarme entendiendo que esto no iba a llegar. Aun así, siempre quise pensar que la familia es esa cosa hermosa de las películas, y no el azaroso grupo que es en realidad. 

Si pudiera decirle las cosas que pienso y siento a mi mamá de hollywood, lo haría sin dudarlo. Y le diría que los ataques no los hago a propósito, y que no puedo parar la ansiedad una vez que ya empezó. Que me esfuerzo todo lo que puedo, pero se filtra por las grietas y es más fuerte que yo. Le diría que si he bajado 12 kilos en 5 meses no es porque esté mejor, aunque me vea "más bonita", sino que no puedo parar de devolver la comida, y a veces como solo para devolver. Que escojo la comida para hacerlo menos doloroso, y que me cuesta devolver la comida de casa. Le diría que tengo cicatrices y quemaduras en las piernas, que los que pasan por el depto no las ven, y los que saben que existe no preguntan tampoco. Que cuando una costra se cayó, quedó un agujero en mi piel que me ponía la carne de gallina, y tuve que parcharlo para no verlo, hasta que curara por sí mismo. Que muchos días quiero no estar viva y que pienso mucho en el Gonzalo, colgando de un árbol en la Campana. Que no puedo decirle a nadie, por que sé que no está bien, que es egoísta y estúpido. Que a veces no puedo controlar las manos, y los golpes son lo más cercano que tengo a la calma. Que eso hace que al día siguiente, sienta en el cráneo todos los golpes y no me permita olvidarme de lo que pasó el día anterior. Que algunas crisis son de miedo, y otras de desesperación. Que no me acuerdo si alguna vez me sentí libre de este peso. Que quiero a mis amigos más que nada, pero no puedo decirles esto tampoco. Que me da miedo que se vayan cuando se den cuenta de que no soy nada, soy menos que nada, soy basura con forma de persona, soy basura fingiendo ser una persona. Y le diría que, incluso después de hablar horas, de lograr con éxito bajar la rabia que le produce verme así, de reunir las energías suficientes para explicarme, no estoy mejor.  Y le diría que recuerde ese momento en que dejó de estar molesta conmigo, que dejó de culparme, que dejó de responderme con gritos e ironías, para que la próxima vez que me caiga en este lento lento angosto y tortuoso camino, no tenga que pensar con pena en el peso que significa velar por su tranquilidad, más que por mi bienestar. 


jueves, 16 de junio de 2016

faldera

susúrrame una vez
entre los brazos
pídeme que te espere
y que te apañe
y ahí estoy y puedo estar
porque llevo tanto esperándote que nada es mucho más

susúrrame una vez más, como hoy.



miércoles, 15 de junio de 2016

"... Vivieron en esta Casa "

You'll be my Frida
i'll be your Diego
you will be my actress
i'll be your director
feets why i need them
if i have the wings to fly
pies para qué los quiero
si tengo alas para volar
girl if i loved you, it was only for the hair
now that you are bold, honey, i don't care
mira que si te quise, fue por el pelo
ahora que estás pelona
ya no te quiero!

lunes, 13 de junio de 2016

A veces basta pestañear un par de veces para hacer que todo cambie

y a veces las oportunidades te salen de debajo de las piedras.

estoy un poco nerviosa, porque independiente de lo que dicta el sentido común, e independiente del modus operandi que ya conozco bastante bien, mañana iré a mi primera "cita" en años y no sé cómo debería comportarme. Si te sostienen mientras están dentro tuyo, te abrazan luego para dormir, te besan, te sonríen, te coquetean, y luego... luego te... te quieren llevar a ....a pasear........... a pasear a los cerros.................y .....................y .... yy.........y enverdadnopuedocontrolarmuybienladesconfianzayelmiedoquemedaqueestetiposeaunreptilenuntrajedehumanoyentiendoquelodemañanaesalgoamistososexualynorománticopordecirloasíperodetodasformastengolevesnauseasquepodríallegaraconfundirconmariposasminúsculasyesqueenverdadnomeacuerdodelaúltimavezquemensentítranquilayalgoasícomoapreciadaaltenersexonopuedodecirquemidesconfianzaessoloparanoiaporquetengopruebasquesemedesbordandeloenfermosquepuedenllegaraserloshombresperomecuestaconcebirquehaygentenormalyquenotieneproblemascuáticosparaexpresarsefisicayemocionalmenteconotraspersonasyesohacequemedecuentadelomuchoquetengoquealejarmedeloshombresquesemehancruzadoydesusamoresmezquinosytristes

jueves, 9 de junio de 2016

últimamente solo puedo hablar con canciones

There was an open chair.
We sat down in the open chair.
I said if destiny’s kind, I’ve got the rest of my mind.
But my heart, it don’t beat, it don’t beat the way it used to.
And my eyes, they don’t see you no more.
And my lips, they don’t kiss, they don’t kiss the way they used to, 
and my eyes don’t recognize you AT ALL

Peras al Olmo

Curiousity becomes a heavy load,
Too heavy to hold, too heavy to hold.
Curiousity becomes a heavy load,
Too heavy to hold, will force you to be cold.

And do me a favour, and ask if you need some help!
She said, do me a favour and stop flattering yourself!
How to tear apart the ties that bind, 
perhaps fuck off might be too kind,
Perhaps fuck off might be too kind



ya no tengo más palabras 
soy muy débil
y llevo mucho tiempo esperando
guardando bajo la almohada 
el deseo que tengo en el corazón
de dejar ir en paz, y con amor
de poder despedirme con un abrazo
y ser con honestidad y recibir honestidad de vuelta


I probably still adore you 
with your hands 
around my neck,
Or I did last time I checked


pero no puedo pedir más peras al olmo
y no puedo seguir pidiendo de quien no puede dar
lo que no tiene dentro de sí



in my imagination 
you're waiting 
lying on your side
with your hands 
between your thighs...

and a smile


sábado, 4 de junio de 2016

-----

pinto y dibujo, mandalas y niñas rosadas
hago tortugas de lana y palitos
cocino, quemo mis manos, la ropa y la comida
escribo, hago esquemas y pongo fechas
costureo, organizo, muevo
recuerdo, me sonrojo y me distraigo
todo para hacer como que no me doy cuenta
que cada mañana, cada medio día, cada noche
quisiera que la vida se fuera como vapor de mi cuerpo
y pudiera no s e n t i r    n a a  a d  a  a

martes, 31 de mayo de 2016

saliendo de las hueás intensas

tengo que reconocer que
las niñas
me ponen
muy muy nerviosa

ya estoy muy vieja como para jotearme gente

domingo, 29 de mayo de 2016

dejar ir

Ayer estaba con tanta sustancia diversa en el cuerpo que ni siquiera pude decir lo que quería decir. escribo aquí porque sé que él ya no lee, y es cobarde y es triste seguir gritándole a la pared porque tengo miedo de perder todo por no poder guardarme mis sentimientos, o porque lo que siento no es conveniente para ninguno de los dos.

En realidad, lo que quería hacer antes de dejarme llevar por la nostalgia, era decirle a la Carla del futuro que lo que sea que esté pensando, ya lo pensó antes; que cuando tenga un kilo de pena y solo quiera volver a saber de él, nada va a haber cambiado; que si tiene rabia, tiene que entender y recordar que no es culpa suya, ni de él, ni de ella; que independiente de cualquier cosa, el amor que tiene guardadito debajo de tantas capas es hermoso, fue hermoso, y debería poder sentirse alegre de haber sentido algo así. Así me siento ahora, como la Carla que lentamente se vuelve la Carla del pasado. Y querría decirle que sé que lo va a extrañar, porque ya lo extraño, y lo he extrañado mucho tiempo. Ha sido mucho tiempo en verdad.

Espero tocar su cara, una vez más, y decirle lo que siento, una vez más. Espero crecer, y espero salir del lugar en el que estoy, y espero que si lo vuelvo a ver, pueda ser yo completamente nueva.

sábado, 28 de mayo de 2016

sometimes i miss you so much i think i might die / bluish

y tengo que tener la media perso
pa dejar ir a alguien como tú

Es tan raro. Extraño leerte, extraño la alegría que me daba el solo decirte 'buenas noches', extraño sentir que escribirte era como hablarte a la cara, todos los días, a cualquier hora posible. Extraño estar tan lejanamente conectada a ti, extraño decirte 'hey' para llamarte, tratando de implicar que sí, estamos encadenados. Extraño el sentir que te alegraba la monotonía de la vida, extraño el sentir que podía apoyarte cuando no eras felíz. Extraño tantas cosas de ti, Nicolás, que llega a ser estúpido. Yo me siento estúpida, por haber llegado a depender a este nivel de ti. Extraño decir tu nombre, que, te lo dije una vez, me gusta tanto. 


no sé si me da el cuero
no sé si podría hacer algo distinto esta vez 

No creo haberlo dicho antes, pero, me hacías (harías, si pudieras) tan feliz, Nicolás. Feliz de una manera que no entiendo bien, feliz con ligereza, feliz con solo hablar, con solo sentirte envolver mi espalda, feliz de solo sentirme al lado tuyo, feliz de escuchar tu voz al otro lado del teléfono,  feliz de escuchar tu voz en mi oído; feliz de hacer planes que no logramos concretar.

esta es una vida que no logramos concretar
es cobarde huir ahora, solo porque te siento
tan tan lejos?
es cobarde si siento que no puedo tolerar
si no puedo seguir esperando?

Me gusta pensar que la vida es larga, que eres tan imbécilmente especial, que a lo mejor de aquí a un tiempo, de maneras que desconozco, encuentre un camino de vuelta. Son mis pequeñas esperanzas...


pero ya no hay camino de vuelta, nunca hubo uno
me perdí buscándolo 
me perdí entera

 Me da pena, buscarte con la mirada en todos lados. Paso por el reloj de flores, y ruego por las malas coincidencias de la vida, por verte a ti y a tu chasca caminando por ahí, bajando las escaleras con tu polola. Llego a la U, tratando de ver si estás con tus compañeros mechoncitos. Espero verte caminar por la entrada de mi edificio con tu familia, viendo el nuevo departamento, encontrarte caminando por el centro...


me resigno a esperar
sin tener ni una migaja de ti?
soy capaz de tal cosa?

La verdad es que el motivo de mi rabia, solo viene a que, yo no puedo controlarme si estoy cerca de ti; te imaginaba sentado al lado mío, como el primer día que fuiste a mi casa, y las ganas incontrolables de tocar tu cara, tu pelo, agarrar tus manos y jugar a hacer dibujitos sobre tu piel. No podía entender cómo te era tan fácil, ahora que estabas pololeando, no necesitarme cerca, siendo que independiente de mi pololeo, yo no podía alejarme de ti. 


esto es
dejarlo ir
un poco más

Y no es solo eso. Perdón, Nicolás, por todos los errores que pude cometer contigo; por todas esas malas decisiones, esa indecisión, o falta de decisión, como sea. En serio, lo siento muchísimo, por todo. 

y no tiene sentido llorar sobre leche derramada
y menos con palabras de hace 5 años
y así lloro sobre cada gota
y es inútil inútil inútil inútil


Te quiero tanto, Nicolás. Gracias por haber estado ahí, y haber sido siempre genial conmigo. Independiente de todo, es justo decir que, espero que seas feliz ahora, espero que te hagan feliz y tú seas feliz desde adentrito. Estudia harto, no dejes que te ganen los ramos fomes. Sería descaro pedirte que llegues a Neurofisiología? Creo que sí. Llega en todo caso, nunca es bueno echarse ramos.


sería descaro?
decirte "llega"
por favor llega hasta mi


Te extraño Nicolás

Te extraño Nicolás.

y espero que tú a mi también 

y espero que tú también a mi

aunque sea una pisquita

aunque sea
con la esquina más pequeñita
de tu corazón









lunes, 23 de mayo de 2016

-

Always and forevermore
I call to say I’m on the way
2000 years remain in a trash can
Let burn the cigarette somewhere
Ashes till it falls, falls, falls

domingo, 22 de mayo de 2016

miércoles, 18 de mayo de 2016

día y tarde

siempre leo chistes respecto a estar en una escena de un vídeo musical, o una película, mientras se escucha música. hoy día lloré afuera del banco, las manos me temblaban al manejar la bici y la ansiedad me comía viva. en vez de ir a Valparaíso, pensando que no llegaba a tiempo al trámite que tenía que hacer, di media vuelta y anduve todo lo rápido que pude hasta llegar al borde de Reñaca. bajé a la roca dónde están las gordas, y me quedé ahí. luego de haber llorado todo lo que pude, y recordando que había traído mis libretas, quise dibujar algo para las enanitas, y así lo hice. luego de una, dos, tres horas, decidí volver. anoté la música, me despedí, y me fui lentamente por el borde costero. para cuando entré a la playa larga, noté que una enorme bandada de pájaros, quizás la más grande que había visto hasta entonces, volaba a raz de la superficie del mar, en la misma dirección a la que me dirigía. "no cars go where we know", y aceleré, aceleré tanto que me ardían los músculos, tratando de mantenerme junto a la bandada. y pensé que parecía una película, pensé que era así de hermoso. con la vista fija en el mar, desviándola ocasionalmente para no chocar con los pocos peatones que habían en mi camino en ese momento. me sentí volar. y volar no es algo que todos vayan a vivir. pocas veces había sentido tanta electricidad en mi cuerpo. 
pocas veces tomo o subo fotos. no quise dejar de correr para detenerme a eso. vivir es lo más hermoso, y a veces no requiere tanto dolor. o quizás, sin el dolor no hubiese sido igual, pero de cualquier manera,  me sentí llena, como parte de algo efímero, irrepetible, y con amargura pensé en él y en su miedo, su necesidad de tomar fotos para no olvidar, y sentí como que tenía algo que él no conocía, algo que no tocó, algo que no tocará jamás, y quizás eso fue lo más hermoso de todo. 

aún así, creo que yo también puedo hacer lo mismo. por algo escribo, y a veces, por algo saco fotos también, a pesar de que hoy en día ni siquiera las mire. por eso, hoy quise subir una foto, y asegurarme de que no se pierda jamás. 






domingo, 15 de mayo de 2016

la vista

Cuando salí a mirar el atardecer, fumándome mi penúltimo cigarro morado que me quedaba, estuve a punto de tomar una foto y decidí no hacerlo. Con el celular en los parlantes, y envuelta en una manta, canté lo que pude

As life gets longer, awful feels softer,
and it feels pretty soft to me.
And if it takes shit to make bliss,
well I feel pretty blissfully.

If life's not beautiful without the pain,
well I'd just rather never ever even see beauty again.
Well as life gets longer, awful feels softer.
And it feels pretty soft to me.




martes, 10 de mayo de 2016

Retazos y borradores que no publiqué

Si tuviera que escribir una carta para alguien que no va a leerla

Le contaría que hoy día llovió. No pensé que hoy día iba a llover, tenía la impresión de haber visto el tiempo y de haber visto puros solcitos en los dibujos del Accuweather. Le contaría que salí igual, buscando un regalito para el día de las madres porque es probable que no viaje. Le preguntaría si tiene tiempo, si quisiera verme unos minutos.  

~

El camino de la playa es uno de mis caminos favoritos. Por motivos obvios, pasar por ahí cuando vuelvo del centro a la casa ya no me causa la misma nostalgia. La maldita baldosa hace que apure el paso hasta llegar a 10, y doblar y pisar el cemento para respirar tranquila y seguir el camino. Ayer, ensoñada, escuchando Wake Up y llorando un poquito, contenta y triste al mismo tiempo, me vi interrumpida por un destello en medio de la calle, acompañado por el ensordecedor sonido de un estallido. Se dispararon las alarmas de todos los autos de la cuadra, y me quedé ahí, inmovil, mirando el bulto en medio de la calle oscura, preguntandome si era pertinente o no seguir caminando. A pasos de aquella cosa, un hombre camina en sentido contrario a la dirección de la calle, y poco más allá una mujer lo espera afuera del auto. Ambos se miran con confusión mientras el hombre sigue caminando hasta alcanzar la esquina de la dirección en la que venía yo, donde otro hombre se encontraba parado. Al llegar, intercambian un par de palabras, y el hombre vuelve hacia el auto donde la mujer le pregunta algo que no logro entender. Sin esperar ese encuentro, sigo caminando, y al pasar junto al misterioso objeto, logro darme cuenta de que los colores grisaseos y forma angular no era un paquete aplastado o un objeto metálico, sino una enorme gaviota. Al momento en que entiendo lo que pasó, escucho al hombre comentarle a la mujer que, tal como había supuesto, la gaviota había chocado con el cableado eléctrico, electrocutándose al instante. En medio de la oscuridad de la noche, las pocas personas que se encontraban en ese punto en ese momento se reúnen al rededor del animal, viendo las marcas de la corriente en cuerpo. La mujer del auto lo toma por las alas, y con cuidado lo deposita a un lado de la calle vacía. De repente, ya nada me importa tanto.

~

Quiero decir esto, no desde el resentimiento o la pena, sino sólo un gran resumen de la persona que ame por estos 5 años que ya pasaron. Y quiero decir que eres la persona más inteligente, curiosa, chistosa, aperrada y hermosa que conozco. Y eres la persona que más he querido en esta vida que no ha sido muy larga tampoco. Pero Matías, no eres una buena persona. Hieres a las personas a tu al rededor, y no te importa. Me heriste a mi, mejor dicho, y no te importó. Quería con todo el corazón creer lo que me dijiste la primera vez que nos juntamos, que era la persona que más querías en el mundo, y que habías entendido lo muy riesgoso que era para mi esto, que no harías algo para hacerme mal. Siempre creí eso, hasta el último momento, incluso ahora. Seguí porque tenía la fe ciega de que en algún momento caerías en cuenta de los efectos de tus acciones, que había alguna posibilidad de cambio en la forma en que te relacionabas conmigo. Y te lo digo ahora porque incluso hoy, tengo la creencia de que algún día vas a cambiar, y vas a ver a las personas no como pasatiempos sino como iguales. Siempre creí también que yo iba a estar ahí, queriendo compartir todo lo que siempre di contigo. Eso es lo único que ha cambiado, porque ahora entiendo que nunca vas a verme de esa forma, y tampoco quiero estar cerca para intentarlo, ni como compañera ni como amiga, ni como conocida, ni como vil recuerdo. 

~

[Croquera] Escuché una banda nueva, que suena mucho como a algo que ya conozco, a algo que conocí. Suena a mi, a ir a caminando sola, a haber [.......] y ahora obtuve resultados, que no son los que quise ni los que esperé, pero estos son.[....] Yo misma por mi misma. 

No desaparecí. Estoy entera, y estoy acá. Por más que quiera sacar cuentas negativas, sigo estando viva. 

Soy feliz de encontrar música así. Por fin sueno a mi misma. 

~

[Croquera] Salí muy tarde de la casa. Cuando iba por 2 Oriente me di cuenta, y troté un poco, mirando las ventanas de los edificios, cada vez menos brillantes. Para cuando llegué, el sol se había metido detrás de unas nubes.
No supe a quién llamar. Estaba tan sola y solo quería, no sé, no estar ahí.
Satisfacción de un impulso que no vuelve, me dije, con el estomago vacío, goce, repetición en búsqueda del placer. Siento los labios secos, pero ni siquiera quiero abrir la boca. 
Estoy tratando de acordarme cómo fue que lo hice.
La incomodidad de existir en mi cuerpo se está volviendo insoportable.   

~

Le pediría contarme todo sobre los viajes que me perdí, y le contaría sobre los lugares que he visto y la música que he escuchado. Preguntaría sobre cómo es su casa y qué le gustaría comer un día. La próxima vez, no seré una bosta y tendré algo bonito para comer, algo que habré hecho yo, y que no me dará vergüenza compartir. Me da vergüenza pedirle que me hable del pasado. Creo que tuve oportunidad de saber de ello en su momento y fue mi propia decisión no hacerlo. ¿Me odiará a veces? ¿Me habrá odiado mucho en todos estos años? Las cosas que realmente quiero preguntar desaparecen siempre bajo un tonel de arrepentimiento y culpa. Es difícil crear nuevos momentos, y ya no puedo aferrarme a los recuerdos viejos. No quiero perder esto definitivamente. 

~

If life's not beautiful without the pain,
well I'd just rather never ever even see beauty again.

  

lunes, 9 de mayo de 2016

i'm so confused
am i a normal person?
you know, i can't tell if i'm a normal person
it's true, i think I'm cool enough 
but am i cruel enough?

am i cruel enough 
for you?

domingo, 1 de mayo de 2016

~~

This will be my monument
This will be a beacon when I'm gone
Gone, gone
When I'm gone
Gone, gone
When I'm gone

So that when the moment comes,
I can say I did it all with love
Love, love
All with love
Love, love
All with love


---

las mañanas son suaves, suaves, suaves y solitarias cuando se te rompe el corazón en los sueños. las palabras se van desprendiendo de a poco, del lugar donde las tengo guardadas durante las emergencias. mi vida ha estado en una emergencia constante hace semanas. pero si puedo volver a escribir, aunque sea un poco, significa que estoy logrando existir de nuevo. 

y me gusta verlo en los sueños, me gusta verlo siempre. me gusta que después de años de naufragar, el amor que tenía tan escondido y aplastado se haya vuelto tan pacífico en el corazón. me gusta sonreír, me gusta que incluso las penas que tengo me hacen sentido, y no son culpa de nadie, y no hay heridas intencionales, no hay cortes o malicia. no estoy acostumbrada, y a veces veo más maldad de la que hay en realidad. pero una vez que logro recordarlo, ya ha pasado, y todavía tengo ese amor tan extraño amarradito a un lado del corazón. recordándome que aunque lo dude casi la totalidad del tiempo, todavía funciono un poco. 

como dice esa canción bonita
 you did not break me 
im still fighting for peace





domingo, 24 de abril de 2016

martes, 12 de abril de 2016

martes, 5 de abril de 2016

no hay música para mi tranquilidad
no hay sonido que acalle el zumbido de mi cabeza
no hay nada que quiera hacer
ni que quiera ser
nada más que nada

Snake Eyes

its in the eyes
i can tell 
you will 
always
be danger

a veces lloro un poco con las canciones que me salen en el reproductor. hoy día, escuché por primera vez en bastante tiempo una canción que decía en pocas palabras todo lo que sentí por varios años, una canción que habla del hogar. y las últimas veces que he podido verte a la cara, veo en ti a la misma persona de la que me enamoré, el hombre inteligente y gracioso y bueno del que me enamoré. mi cuerpo reacciona de la misma forma. mi mente repasa el hogar que perdí, los sueños que perdí, la felicidad que perdí. mi cuerpo lo sabe.
pero mi cuerpo recuerda otras cosas también, y el miedo a hablar, enraizado profundamente en mi estomago, en las nauseas, en las ganas de llorar que surgen cada vez que quiero decir algo, cada ves que me molesta algo. "la amenaza del abandono". ¿crees que podría confiar en ti? ¿crees que hay algo en ti que merezca ser confiado?

cuando hablamos, me sentí tan inferior, tan atrapada en mi propio sufrimiento. yo no quiero nada bueno para el resto, aunque sea ya no. pero debo recordar que el dolor es mi mejor defensa, que cada ves que me sienta cómoda debo recordar, contar las infinitas veces que me caí, las mentiras, una tras otra, las cortinas de humo, el sentir que cada cosa mala que pasaba entre nosotros era mi culpa, las disculpas, perder noción de lo que realmente había pasado, cada momento que me quedé sola con nuestros problemas entre las manos, tu egoísmo infinito, saber que ni en los días en que nos amabamos te preocupaba mi malestar, menos hoy en día. incluso luego de todas las cosas horribles que pude haber hecho, no creo que haya ni un solo problema que no haya podido resolver si todo el esfuerzo que puse en esto hubiese sido reciprocado

cada vez que estoy cerca tuyo, mi cuerpo pide a gritos disculparse. no porque no haya pedido disculpas por mis errores, sino porque no sabe hacer otra cosa. cuando me dijiste que estabas siendo egoísta, no lo entendí al principio. ¿no es esto lo que yo quiero también? el punto no era ese, el punto es que no importaba si lo era o no. esto sigue siendo únicamente para tu estabilidad emocional... y vas a utilizarme para conseguir lo que quieres, y nada más. porque no hay entrega en nada de lo que eres en este mundo. 

ahora, la pregunta es  ¿cómo pasar por el sendero de las espinas y seguir caminando?  ¿cómo salir airosa? si es el camino que debo transitar de todas formas... tengo que comerme al mundo. 

lunes, 4 de abril de 2016

Float on

he evitado con todo el corazón en este último tiempo necesitar a alguien. quisiera poder eliminar de mi vida las "necesidades" y vivir solo de lo que quiero o no quiero hacer, puedo o no puedo hacer.

y he estado buscando cualquier excusa, cualquier palabra en mi diccionario para evitar decir esas horribles frases de 'quería verte porque te necesito', 'necesité verte', 'quería verte porque te extraño', 'te extraño' y cada cursilería horrible que se me cruce por la cabeza. Pensé los motivos más maduros de hablarle y escogí las palabras más adecuadas en mi conversación ficticia. Subí a Sausalito, escuché música en mi recién bajado Spotify y lo maldije por haber afectado mis gustos musicales de esa manera. Maldije, maldije, rogando encontrármelo arriba. Y cuando llegué y no estaba, terminé de darme cuenta lo mucho que me he estado esforzando en sonar distinta cuando a veces todavía me siento como la misma en el interior. Sé que ni siquiera lees esto, pero me de cierto consuelo poder escribirlo.

¿Sabes que te extraño, verdad?
¿Sabes que te quiero un montón?
¿Sabes que te extraño?

Sé que si escribo lo único que voy a conseguir va a ser una respuesta miserable y que no ha pasado tanto tiempo desde la última vez que hablamos y quien sabe cuanta defensa más. Pero estoy muy cansada, y solo quiero saber de ti, sin defensas, sin carcasa, sin nada que es lo que te mantiene tan lejos.

jueves, 31 de marzo de 2016

salad days

cuando venía en la micro ayer, pensé que si no podía volver a depender nunca más de alguien para sobrellevar mi ansiedad, veía complicado volver a querer a alguien y querer entregar de mí, sin que este sea de alguna forma un apoyo para mi. últimamente, no siento que merezca el apoyo de nadie, ni que valga la pena que alguien la pase mal por mi incapacidad de vivir como la gente. eso me deja pocas posibilidades, porque el único tipo de relación en el cual podría sentirme acogida no es más el tipo de relación que quiero en mi vida, y eso me hace sentir profundamente sola.

hay días en la noche en que creo que no puedo vivir mucho, como si mi cuerpo realmente fuese a dejar de funcionar. no entiendo qué lo mantiene moviéndose y quisiera que no lo hiciera más. comer es de lo peor del día, estoy tan cansada de tener que hacerlo para vivir. quisiera cocinar y cocinar y no tener que comer jamás, dejar de tener un estómago, funcionar solo a base de aire.  

creo que me gustaría vivir en una casa pequeña frente al mar, por si cualquier día solo quiero entrar al mar y quedarme ahí. contemplar la posibilidad y nunca huir de ella. despertar cada mañana con el recordatorio en la ventana.

¿tengo todavía cosas que esperar? ¿es egoísta pensar así?



Always feeling tired, smiling when required
Write another year off and kindly resign


ya no me siento para nada como una persona

sábado, 26 de marzo de 2016

en medio de una tarde ansiosa solo pensé que quería apoyar mi cabeza en el pecho de alguien
y nada más

no quiero soñar contigo

ya hace cerca de un mes que no sé de ti y no quiero volver a escribir
quiero decirte 'adiós,  no me escribas más!', hasta darme cuenta de que bueno, no me has escrito más. no quiero pensar en ti ni en tu existencia

y si tengo que volver a ver tu cara
con tu mirada huyendo de la mía
creo que voy a explotar

viernes, 25 de marzo de 2016

Si llego a sentirme mal

tengo tantas cosas que recordar
si llego a entristecerme
o a sentirme herida
no puedo volver a caer en la inercia
ni puedo creer
en esa cara
si eres lo que más amé-
tengo que acordarme de esa frase rara de la renovación de las células
si eras lo que más amé
si eras con quién quise pasar los minutos de mi vida
esa persona
está lentamente desapareciendo
hasta que ya no quede nada en ese cuerpo que yo haya amado

cuando logre sentir eso
cuando logre verlo y saber que ya no está
voy a poder ser libre
y sonreír y ser inmune
invencible
contra el peso de todos mis sueños hechos añicos
mirarte a la cara y ver a una persona nueva
lo seas o no en realidad

martes, 22 de marzo de 2016

Babel

Press my nose up, to the glass around your heart
I should've known I was weaker from the start,
You'll build your walls and
I will play my bloody part
To tear, tear them down,
Well I'm gonna tear
TEAR 
THEM 
DOWN

jueves, 17 de marzo de 2016

decantando

pensé que me había abierto una herida
pero es dificil determinarlo en una situación como esta

hay cosas que quiero decir y que todavía no puedo ordenar.
tengo hartos miedos hechos un nudo cerca de la boca de mi estómago
no se dejan distinguir, y hacen que no pueda comer

pero tengo muchas cosas que no tenía antes, y es como estar mirando mi propio cuerpo desde afuera. en realidad, nada de lo que ocurra va a ser peor de lo que ya pasó
y ese es un pensamiento muy tranquilizador

lo peor ya pasó, lo peor ya pasó

miércoles, 16 de marzo de 2016

domingo, 13 de marzo de 2016

collage

vuelvo a dormir con los pies en la cabecera

a veces creo que si no me sintiera enferma, no estaría viva. mi sistema digestivo está dejando de funcionar, estoy segura, pero todo lo que hace me mantiene de pie

(no ha escrito. tengo que saber que no va a escribir, tengo que entenderlo ahora ya)

después del funeral, decidí hablar con él. no lo he hecho, ni creo que lo haga en realidad. alguien me dijo 'escribe lo que quieras decir, así no se te olvida'. a ratos creo que prefiero que se me olvide, tengo miedo de perder la cabeza. tengo miedo de que al no decirlo con mis propios labios se disuelva en la melancolía

pocas cosas son tan desproporcionadas y esta es una. si todo se mantiene como está ya no hay qué me amarre. me apena haber comprado imanes.






lunes, 7 de marzo de 2016

can you save

can you save my 
can you save my
heavy dirty soul?

es necesario a veces entrar a la cocina y no salir de ahí hasta haber dejado el miedo y la ansiedad entre el uslero, los sartenes y los aliños. en verdad no siempre lo logro, a veces vuelvo a mi pieza y sigo con pena de vida y cansancio y la impresión de que esto no se va a acabar nunca. 

es necesario a veces hablar con la gente que está cerca también, aunque no hayan estado desde siempre, y aunque uno piense que quizás no estén por mucho tiempo más tampoco -el miedo a la pérdida siempre salpica mis conversaciones-

lo que quiero decir es que aprendí a hacer seitan, y trato mucho de no depender de nadie (nunca más) para sobrellevar mi ansiedad, pero aun así agradezco a quienes están cerca

heavydirtysoul

no me he estado sintiendo como una persona últimamente

martes, 1 de marzo de 2016

es una estupidez

la forma en que nos afecta la muerte de los demás... siempre pienso que es egoísta entristecerse, pensar en cómo te afecta que alguien ya no esté, siempre pienso que hay otra persona que está más triste, alguien que perdió mucho más. yo sólo sé que tengo una foto guardada, una foto de una broma que iba a hacer (en verdad era muy graciosa, y mandarla por correo parecía una muy buena idea), broma que nunca llevé a cabo. no era mi amigo, pero era valioso. y me siento extraña compartiendo un dolor que parece tan ajeno. recuerdo que lo conocí el primer lagunazo, y me produjo mariposas. nunca pasó nada, y las mariposas desaparecieron pronto.
son cosas, tonteras, que se quedan grabadas cuando alguien decide desaparecer antes.

martes, 23 de febrero de 2016

Sueños


You said no one would ever know
The love that we had shared.
As I took my leave to go
It was clear you didn't care

Where are you now?
Where are you now?
Do you ever think of me
In the quiet, in the crowd?


A veces creo que las canciones se ensucian con malos recuerdos, sentimientos desagradables, cosas que uno no quiero recordar. Hoy día soñé con alguien que me hizo despertar y sentir que mi corazón se apretaba, solo de darme cuenta que lo había visto en nada más que un sueño. No deja de ser gracioso, porque en este, lo veía en un encuentro tal como los que hubieron muchos, que me hicieron dejar de hablarle por un tiempo. "Tienes tiempo? puedo verte?" y los respectivos motivos para aplazar eternamente el encuentro. De todas formas, cuando desperté, luego de esperar con el paso de los minutos que se disipe el dolor físico de la ansiedad y la taquicardia, sonó esta canción, clara en mi cabeza, limpia de toda la mugre que se le había acumulado encima. La pena, la melancolía, no son un mal sentimiento, no como la rabia o el resentimiento. Hay algo casi maravilloso en doler al extrañar a alguien... es una espera hermosa. No siempre, pero sí hoy. 


And I hear of your coming
And your going in the town
I hear stories of your smile
I hear stories of your frown

And the darkness can descend
We can relish all the pain
But I know that's what you love
Cause you know I love the same


lunes, 22 de febrero de 2016

sábado, 20 de febrero de 2016

Hola hola!

Días como los de hoy no llegan a propósito, por más que lo planee. Y si bien nunca he sido una mujer mística, el que me llegue la regla siempre me pone en una situación especial, algo así como una disposición que va más allá del estado de mis hormonas. Me dan ganas de tener un día para mí, y de tanto en tanto el universo conspira para cedérmelo. Hoy, desperté y me sentía ansiosa hasta hace poco. Fui con mi familia a almorzar a un restaurant vegetariano que queda cerca, que no era tan caro y, si bien tampoco había gran variedad, estaba todo muy rico. He estado trabajando en mi pequeño telar, y avanzando mis proyectitos con la máquina de coser (que decide echarse a perder cada vez que hago un maldito doblez). Ahora tiño ropa que he guardado por años, sin saber qué hacer con ella y que por motivos sentimentales no logran salir por la puerta de la venta o el regalo. Bajo una película de terror gringa, y cargo por mientras una asiática en otra ventana. La luz tenue de mi cocina me recuerda las tardes que pasé aquí cocinando con la única compañía de mi computador y mi disco duro, con todas las películas de terror que había logrado acumular en ese entonces. Demoraba tardes enteras en hacer platos relativamente simples, todo por el gusto de juntar dos de mis pasatiempos favoritos: cocinar mientras veo películas, si es posible de terror, y, muy de vez en cuando, de cocina también (digo, de cocina de terror... Véase los Tres Extremos).
El transcurso del día mejora a medida que la gente va saliendo de la casa, y esta se va quedando en silencio. Es fácil ponerse melancólica así, pero creo que es más lo feliz que me hace poder estar conmigo misma. Maravillosa calma entre tanta tormenta.

domingo, 14 de febrero de 2016

Quisiera preguntar

si fuiste tu
qué querías decir
qué querías oír

Pero sé que es una de esas cosas de las cuales nunca me darás una respuesta.

sábado, 13 de febrero de 2016

For love, you are aside of me.... everyday.

"recuerdas que pasamos tantas weas, y que ahora podemos olvidarnos de las mierdas y ser felices, me encanta que podamos!, o que en algunos casos intentemos y demos nuestro mayor esfuerzo,SOMOS LA PAREJA MAS PERFECTA dentro de las parejas perfectas 99, uno para el otro, cocinero y comidita, sopaipilla y pebre, McQueen y  esquizofrenia , uno para el otro amor <3 mi media naranja espero estés feliz de leer que me preocupo por ti, que mañana será un dia lindo dentro del poco tiempo que tengo >,< , no te prometo nada pero espero me salga todo bien :c y como ya sabras, no suelo tener planes muy claros c: , pero pero lo intentoo!, y recuerda que me gusta todo de ti..eres linda… e,e <3, oesa xD, eres linda (ignorando esa canción) y me gustas y te amo <3"

Hay días en los que me permito llorar. Hoy me permití abrir la carpeta que ya solo lleva tu apellido. 

"No sabría poner en una miserable cartita, todo lo que ha sido para mí este año al lado tuyo. Hemos caídas muy feas, choques de cara contra el suelo; hemos tenido momentos perfectos, que me dan como una tierna angustia de solo recordarlos; y hemos tenido la mejor parte, que es la que se encuentra justo al medio: luego de varios meses de esfuerzo y dedicación, hemos podido pasar cada pequeño día juntos, de una u otra manera. El salir juntos a pasear por la ciudad de la mano, el acompañarte en trámites y tonteras, el tratar de hacer cada día especial con paseítos y dulcecitos, el planear juntos aventurillas y llevarlas a cabo, el compartir noches cansadas cortadas tempranamente por horarios de universidad, el tenerte ahí, durmiendo junto a mí, el despertarte con desayunos inventados ahí mismo,  el cocinar cosas extrañas y gordas para ver películas que nunca terminamos, el hacer el amor contigo, o el simplemente sentir tu cuerpo junto a mí; eso, todo eso; es lo mejor en demasiadas formas, y es más de lo que podría pedir de mi vida. Suena como demasiado, e incluso exagerado, pero es que no sé cómo o porqué, alegras toda mi vida. A veces trato de imaginarme este año que ha pasado sin ti, y no puedo, y no podría imaginarme ningún año de los que se vienen tampoco"

Guardé esto con recelo, muchos años, como si fuesen mi tesoro más preciado. Hoy día no son más que palabras en una hoja de word. Encontré también una carta, que decía "hueá carta no entregada" en el título, y que estaba escrita en un blog de notas. Dice que está escrita el 2012.

No sé si voy a mandar esto, o si va a ser una carta o si va a ser solo una entradita en mi blog. 
La verdad, es que me pongo bastante mamona escuchando L'arc y este pc tiene esos 'gadgets' que 
hace que uno pueda poner tonteritas en el escritorio, por lo que puse una presentacion de fotitos, 
todas las que puse en el album que te regalé. Justo ahora escucho Flower, y me acuerdo de esos días
 que estuvimos separados, y que la escuchaba siempre y me acordaba de tí, tratando de definir cosas
 en mi cabeza y blah. Me acuerdo de cuando salímos, y era tan extraño, porque lo único que pensaba 
era que me sentía cómoda y alegre estando contigo, y solo me mezclaba la cabeza.  No sé, me dijiste
 que descanzara, pero sabes que no puedo dormir mucho y menos en un bus, (el cual, ironicamente, me tocó MUY ruidoso), 
entonces, en realidad lo único que he hecho ha sido pensar, y jugar sudokus, obvio. He tratado de alejar los pensamientos 
negativos de mi cabeza, las preguntas tristes que aparecen. De repente, los recuerdos me llegan con nauseas y dolor de 
estomago. Pienso en si estoy siendo optimista o negativa, en pensar lo mejor y decir 'vamos a superar todo esto, sea lo
 que sea', o pensar si es que habrás pensado en terminar todo esto. Pienso en si habré empezado a alejarte de mí, o en 
cómo sería, si me estuvieras dejando de amar de a poquito. Nos vemos tan alegres en las fotos. No sé si arruiné todo muy 
definitivamente. 
No sé si ser optimista al respecto tampoco, el optimismo ya me ha jugado malas pasadas. Pienso en que todo
 esto es culpa de mis inseguridades, y en cuanto tiempo más podrás seguir lidiando con ellas; si alcanzaré a deshacerme de 
ellas antes. No sé, realmente he pensado demasiado en este viaje, tal vez. Pero en realidad, más que nada, he pensado en tí. 

En cuando salíamos en verano, y tenías el pelo todo largo, y lo que me gustaba verte reír, porque lo encontraba raro. 
Esa risa de carcajada, digo. En cuando fuiste a Caldera y caminaste hasta el faro, mientras yo estaba en el valle y 
te llamaba. Todos me preguntaban si eestaba en algo, y yo decía que no, que algo pasaba pero que yo no te gustaba mucho.
 Me acordaba de cuando fuimos a comer sushi, y me pediste que fueramos novios 'de verdad'. 
Cuando fuimos a la playa, y caminamos, y había ese show extraño, y no lo vimos; nos fuimos caminando, aunque fuera de noche.

 De cuando iba a tu casa y hacíamos cositas, y yo no hacía nada porque le tenía terror a hacer cualquier cosa mal; 
el miedo siempre me ha congelado un poco. De cuando ordenaba tu pieza, de cuando me despertaba a las 3 de la mañana 
para irme a mi casa, fingiendo que venía de una junta con las niñas. De la primera vez que despertamos juntos, 
en la mañana (pijamada donde la pancha (?)). De estar en Viña, y solo unos días despues, me fueses a ver, y 
tuviesemos el fin de semana más extraño, bonito y caótico/terremoteado/tsunamizado. De lo que busqué un pijama que fuera
 bonito, y me terminé comprando solo el más barato. De las cosas cerdas que comimos, y sushi om nom nom. De la parte dificil,
 de las semanas, e incluso meses que pasabamos sin vernos. De las pataletas que te hacía porque no querías poner la cámara. 
De lo mucho que te extrañaba, y el buscar cada ocasión para ir a Serena. Los tramites para que te vinieras, tú llendo a la U,
 las peleas, nosotros tratando de resolver todo, los problemas. El paro, y la ocasión para poder estar juntos normalmente.
 Onces en tu casa, comer pizza con marrasquinos. Tú por fin en VIña, yo en serena todavía. La distancia, el miedo, 
la confusión, ambos por fin juntos en Serena, mi quiebre. Cuando me pediste intentarlo, cuando me dijiste que no tenía
 que estar segura, solo querías que lo intentara. Me demoré, algunos problemas siguiera, pero pasa el tiempo y el verte
 cada día, el dormir contigo, el convivir contigo,  me hace preguntarme cómo dudé aguna vez. Trato de imaginarme este año
 sin tí, y no puedo. Imaginarme Viña sin tí, mi vida sin tí, y no sé qué sería de mi. Es tan distinto a como fue siempre 
en mi vida, pero tal como lo quiero. A tí, solo a tí, chascón, distraido, sonriente, tierno de maneras que no creo que 
entiendas, tierno en cada gesto inconciene y en todo lo que haces sin pensar. Creo que he pedido muchas disculpas, pero 
sigo sintiendo que me falta algo por explicar, tal vez. En una entrada anterior, mencioné algo de las escenas como formas
 de explicar lo que siento. Hay una frase de Chuck Bass, de Gossip Girl, que dice ' i only turned dark and desesperate 
cause i was afraid of losing you'. Y yo sé que no es excusa, y que todo ya está más que dicho, y que mis celos son siempre
 injustificados... pero, si puedira explicarte que, pasé por mucho para darme cuenta de lo realmente fundamental que eres 
para mi vida, que me haces felíz por solo existir. Pasé, pasamos por tanto. Sé que te amo, con todo lo que puedo amara 
alguien, pero, después de todo lo que ha pasado, lo que he hecho talvez, mis actitudes de mierda y mis estallidos, tengo
 miedo de que tu cuerda se vaya acortando, y tengo miedo de que encuentres a cualquier persona que comparta más cosas 
contigo, más de 'tu tipo', y te muestre que no todas las muejeres somos perras histericas, y que yo, en mi desesperacion, 
reaccione cada vez peor. Creo que te lo dije, es un circulo vicioso. Tengo tanto miedo de que te des cuenta de todas las
 cosas malas que tengo, que te vayan saturando de a poco, y alcances un limite. Todos tienen un limite. 
No sé como expresar bien, lo insuficiente que me siento... y lo peor, es que no es culpa de nadie más que mía. Trato de
 entender nuestros problemas, y veo que la mayoría surgen de mis actitudes de mierda, que solo son reflejo de la angustia 
que me da el perderte. Siento que nos afecto, a ambos, y me pregunto a cada rato, es esto justo? Y cresta, no lo es. 
Pero a cada indicio, cada pequeño detalle de que hay alguien acercandose a tí, el dolor llega a ser físico, y me desespero
 y lloro tratando de pensar como arreglar esto, como confiar (no en tí, porque en tí confío, si no que en mí, en pensar que
 soy suficiente para alguien). Y siento que llego al punto de profecía autocumplida, me volví tan loca que te espantaste, 
te preocupaste, y te cuestionas qué pasa conmigo, con nosotros. Mis peores miedos se cumplen solo a raíz de mis miedos.
 Igual, después de pensarlo un rato, no escribo esto para inspirarte pena. Solo quiero que entiendas que hay muchas cosas, 
más de las que podrías creer, que estan mal conmigo. Y que trato de superarlas, pero necvesito ayuda. Ayuda de más, no como
 a cualquier persona con algun complejo, si no que como tú me has visto, y cómo has visto que mis miedos me afectan.Y me da 
miedo, tengo miedo que ya sea mucho pedir a estas alturas, y tengo miedo que implique demasiado de tí, más de lo sano. 
Y tengo miedo de perderte en el camino. No sé como equilibrar el tratar de tratar de librarme estos complejos, con el 
hacerte feliz. 



Aish. No sé, ya no recuerdo qué escribí. Solo he pensado tanto en tí Matías, solo quiero hacer las cosas bien.



Ya ni siquiera puedo recordar por qué la escribí.  Era el 2012, y yo todavía trataba de creer. Estamos en el 2016 ahora, y todo es tan lejano que parece venir de otra vida. ¿Cómo pudimos ser felices tanto tiempo, y dejarlo morir como murió? Creo que lo que nunca entendí del "duelo" es lo súbito, lo inexplicable. Como se te hubiese tragado el mar... cuando hubiese querido que me tragara a mi.